ABSTRACT
Introducción. La pandemia por COVID-19 ha llevado a modificar la estructura asistencial en los hospitales alrededor del mundo, buscando la mejor forma de adaptarse para responder al incremento de pacientes infectados por el virus, sin desatender las necesidades de los pacientes no afectados por el mismo. El objetivo de este trabajo es describir la percepción de la comunidad quirúrgica sobre el impacto que ha tenido la pandemia COVID-19 en los servicios de cirugía en Colombia.Métodos. Estudio de corte transversal descriptivo mediante encuesta estructurada compuesta por 10 preguntas de selección múltiple y 8 preguntas con ítems tipo Likert. Se distribuyó electrónicamente a residentes de cirugía general, cirujanos generales o sub-especialistas que tuvieran práctica clínica en Colombia. Resultados. Se incluyeron 464 participantes, 27.8 % fueron mujeres y 45.3 % cirujanos generales. Alrededor de la mitad residían en Bogotá (51.4 %) o trabajaban en un hospital universitario privado (48.3 %). El 78.8% de los encuestados consideraron que las recomendaciones de seguridad son efectivas y 76.6% se sienten seguros realizando procedimientos con ellas. Sin embargo, el 63% consideran que estas se cumplen parcialmente. Hasta el momento, 20% de los participantes reportó haber tenido contacto directo con pacientes COVID-19 positivos. Finalmente, la mayoría (93%) están de acuerdo con la cancelación de procedimientos electivos y están dispuestos a ser reubicados en otros servicios en caso de ser necesario. Conclusiones. Para el inicio de la fase de mitigación en Colombia existe consenso en la percepción del impacto de la pandemia COVID-19 en los servicios de cirugía. No se observó una variabilidad significativa respecto al nivel de entrenamiento ni al tipo de institución hospitalaria
Introduction: The COVID-19 pandemic has led to changes in the care structure in hospitals around the world, seeking the best way to adapt in response to the increase in patients infected with the virus, without neglecting the needs of patients not affected by it. The objective of this study is to describe the perception of the surgical community on the impact that the COVID-19 pandemic has had on the surgical services in Colombia.Methods: Descriptive cross-sectional study using a structured survey consisting of 10 multiple-choice questions and 8 questions with Likert-type items. It was distributed electronically to residents of general surgery, general surgeons, or sub-specialists who had clinical practice in Colombia.Results: 464 participants were included, 27.8% were women and 45.3% were general surgeons. About half resided in Bogotá (51.4%) or worked in a private university hospital (48.3%). 78.8% of the respondents considered that the safety recommendations are effective and 76.6% feel safe performing procedures with them. However, 63% con-sider that these are partially met. So far, 20% of participants reported having had direct contact with COVID-19 positive patients. Finally, the majority (93%) agree to the cancellation of elective procedures and are willing to be relocated to other services if necessary.Conclusions: There is a consensus in the perception of the COVID-19 pandemic impact in the surgery services without observing significant variability regarding the level of training or the type of hospital institution
Subject(s)
Humans , Coronavirus Infections , Perception , Surveys and Questionnaires , PandemicsABSTRACT
Objective The health needs of older adults constitute challenges for health monitoring and care, resulting in increased costs. The present study therefore sought to analyze the health status of the elderly to enable targeting and intervention, in the pursuit of healthy aging for all. Method A quantitative observational cross-sectional study using a primary source was performed in 2012. A total of 4,248 adults aged over 60 years of age residing in the nine regions of Antioquia, Colombia, and the capital city were surveyed. Univariate, bivariate and multivariate analysis was performed of statistical and epidemiological measures, based on confidence intervals and statistical tests under 5%. Results One in four individuals had a risk of depression, one in three were at risk of anxiety, eight out of ten had cognitive impairment, mainly mild, and the same proportion were at nutritional risk. The elderly persons suffered from all types of abuse, notably psychological. Conclusions Thehealth status ofelderly personsis more affectedbymental than physical healthrisks, indicatingthatpublic policy anda better distribution ofresourcesshould be aimed at seeking animprovement in qualityof life anddignified aging, differentiated byregion.
Objetivo Las necesidades de salud de los adultos mayores se constituyen en retos por los requerimientos de atención, cuidado e incremento de costos, por eso se buscó analizar el estado de salud del adulto mayor que posibilite la focalización e intervención oportuna, en la búsqueda de un envejecimiento saludable para todos. Método Bajo un enfoque cuantitativo, se realizó un estudio observacional, descriptivo transversal de fuente primaria, encuestando a 4.248 adultos mayores de 60 años de edad, residentes en las nueve subregiones del departamento de Antioquia, Colombia y la ciudad capital en el segundo semestre del año 2012. Se realizaron análisis univariados, bivariados y multivariados, en el cálculos de medidas estadísticas y epidemiológicas, intervalos de confianza y pruebas estadísticas menores del 5%. Resultados Uno de cada cuatro presentaron riesgo de depresión, uno de cada tres tenían riesgo de ansiedad, ocho de cada diez presentaron deterioro cognitivo, principalmente leve, y riesgo nutricional en igual proporción. Se evidenció todo tipo de maltrato contra los adultos mayores, siendo mayor el psicológico. Conclusiones El estado de salud de la persona mayor se ve más afectado por los riesgos en la salud mental que en la física, que permiten el direccionamiento de las políticas públicas y una mejor distribución de recursos en la búsqueda del mejoramiento en su calidad de vida y un envejecimiento digno, diferenciando por la región de residencia.
ABSTRACT
Dentro de la clasificación de linfomas cutáneos primarios de células B se encuentra el linfoma de células B tipo pierna. El mismo se presenta más frecuentemente en mujeres de edad avanzada. Existen diferentes opciones terapéuticas para este linfoma. Presenta regular pronóstico. Presentamos una paciente de 58 años con una lesión tumoral en antebrazo izquierdo. Con la clínica, la histopatología y la inmunohistoquímica se realizó el diagnóstico de linfoma B primitivo cutáneo difuso de células grandes de la pierna localizado en el antebrazo. Realizó tratamiento con quimioterapia con CHOP, pero debido a la mala respuesta al mismo, se decidió la amputación del antebrazo izquierdo...
Subject(s)
Adult , Female , Lymphoma, Non-Hodgkin , Skin , Forearm , Leg , NeoplasmsABSTRACT
El objetivo del estudio fue evaluar las actitudes y conocimientos de 40 participantes pertenecientes a diferentes esferas sociales frente a las intervenciones neurocientíficas en ensanchamiento o mejoramiento cognitivo. Esto, con el fin de explorar en qué medida encuentran moralmente aceptable los desarrollos biotecnológicos en las neurociencias del comportamiento. Se realizó un análisis cuantitativo y cualitativo. No se encontraron diferencias en la actitud hacia las intervenciones según el nivel de conocimiento. Por último, se observó una tendencia central en lo que respecta a las percepciones éticas sobre estas intervenciones, a pesar de encontrar diferencias de aceptabilidad moral en los diferentes grupos.
This study was aimed to assess attitudes and knowledge of 40 people from different social status toward the scientific interventions in cognitive neuroenhancement. It is in order to inquire about the moral acceptance of the biotechnologically viable in behavioral neuroscience. Both, quantitative and qualitative analyses were performed. No differences in attitude towards interventions according to the level of knowledge were presented. Finally a central tendency was observed toward the ethical perceptions about the mentioned interventions, in spite of having found moral differences in moral acceptability among the different groups.
ABSTRACT
Algunos trabajos de investigación informan que cierto número de niños superdotados muestran problemas de adaptación social y habilidades sociales e interpersonales, mientras que otros consideran que esto no ocurre. Partiendo de lo anterior, Neihart, Reis, Robinson y Moon (2002) hablan de enfoque de resiliencia versus enfoque de riesgo. En este trabajo se considera el beneficio de aplicar programas de entrenamiento en habilidades interpersonales en niños superdotados para prevenir posibles problemas. Por ello, se pretende valorar la eficacia de un programa de entrenamiento en resolución de problemas interpersonales en esta población. En esta investigación participaron 40 niños superdotados de edades comprendidas entre 7 y 13 años, divididos en un grupo tratamiento y un grupo control de lista de espera. Los resultados mostraron diferencias significativas en las medidas de valoración directa en el grupo tratamiento tras la aplicación del programa. También se detectaron diferencias significativas entre el grupo tratamiento y el grupo control en las medidas postratamiento a favor del primero, y se confirmó la relación del potencial de aprendizaje de los niños con los beneficios obtenidos. En definitiva, el programa de entrenamiento se muestra eficaz en la mejora de las habilidades de solución de problemas interpersonales evaluadas en niños superdotados.
Certain research studies report that a number of gifted children show social adaptation issues, as well as problems with social and interpersonal skills, while others consider that this does not occur. In this regard, Neihart, Reis, Robinson and Moon (2002) speaks of a resilience approach versus a risk approach. From the risk viewpoint, this paper presents the benefits of applying training programs in interpersonal skills as to prevent potential problems in gifted children. For this reason, we aim to evaluate the effectiveness of a training program for solving interpersonal problems in this population. Participants include 40 gifted children aged 7 to 13, divided into a treatment group and a control - waitlisted - group. Program application results show significant differences in direct assessment measurements in the treatment group. An increase in effect sizes between the treatment group and the control group is also detected, in favor of the former, and a relationship between the children's learning potential and the benefits obtained is also confirmed. In short, the training program proves effective in interpersonal problem-solving skill improvement in children with high intellectual capacity.
ABSTRACT
El objetivo de la presente revisión es presentar un panorama del desarrollo de dos modelos explicativos: la teoría de la mente y la teoría de la alteración de la función ejecutiva en los trastornos del espectro autista (TEA). Para ello, parte de una descripción de las manifestaciones clínicas del TEA y de sus bases neuroanatómicas. Se concluye, que los dos modelos ofrecen explicaciones que bien podrían complementarse para ofrecer un marco explicativo integral. Finalmente, se hace una presentación de algunos enfoques terapéuticos que han mostrado su efectividad en este trastorno.
The aim of this review is to present an overview of the development of two explicative theories: the theory of mind and the impaired executive funtion in autism. Thus, the review begins with a description of the clinical manifestations of autism and its neuroanatomical basis. As a conclusion, both models offer complementary theories that could be integrated in order to provide a comprehensive explanatory framework. Finally, the article introduces some therapeutic approaches that have being effective when dealing with this disorder.
Subject(s)
Humans , Autistic DisorderABSTRACT
Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2 percent w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100 percent were found, predictive positive and negative values were of 100 percent respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method) provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.